Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #72575)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 72575 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5300
  • Total vector size (bp) 5500
  • Modifications to backbone
    CMV-Venus cassette is inserted into the EcoRI and NotI sites.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • gRNA/shRNA sequence
  • Species
    M. musculus (mouse), R. norvegicus (rat)
  • GenBank ID
    NM_053460.1 NM_008837.3
  • Entrez Gene
    Pick1 (a.k.a. Prk, Prkcabp)
  • Entrez Gene
    Pick1 (a.k.a. Prkcabp)
  • Promoter H1 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer gccctgcaatatttgcatgtcg
  • 3′ sequencing primer ATTAACCCTCACTAAAGGGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVenus-PICK1-shRNA was a gift from Victor Anggono & Richard Huganir (Addgene plasmid # 72575 ; ; RRID:Addgene_72575)
  • For your References section:

    PICK1 loss of function occludes homeostatic synaptic scaling. Anggono V, Clem RL, Huganir RL. J Neurosci. 2011 Feb 9;31(6):2188-96. doi: 10.1523/JNEUROSCI.5633-10.2011. 10.1523/JNEUROSCI.5633-10.2011 PubMed 21307255