pLL3.7-TNFa-shRNA3
(Plasmid
#72598)
-
PurposeExpress shRNA against mouse TNF-alpha
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72598 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepLL3.7
- Backbone size w/o insert (bp) 7650
- Total vector size (bp) 7692
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse TNF-alpha shRNA
-
gRNA/shRNA sequenceTNF-alpha
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_013693
-
Entrez GeneTnf (a.k.a. DIF, TNF-a, TNF-alpha, TNFSF2, TNFalpha, Tnfa, Tnfsf1a, Tnlg1f)
- Promoter mouse U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AGACTTGTGGGAGAAGCTCG
- 3′ sequencing primer GGGTGAGTTTCCTTTTGTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone is available through Addgene.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLL3.7-TNFa-shRNA3 was a gift from Kazuhiro Oka (Addgene plasmid # 72598 ; http://n2t.net/addgene:72598 ; RRID:Addgene_72598) -
For your References section:
Gene therapy for neuropathic pain by silencing of TNF-alpha expression with lentiviral vectors targeting the dorsal root ganglion in mice. Ogawa N, Kawai H, Terashima T, Kojima H, Oka K, Chan L, Maegawa H. PLoS One. 2014 Mar 18;9(3):e92073. doi: 10.1371/journal.pone.0092073. eCollection 2014. PONE-D-13-38046 [pii] PubMed 24642694