-
Purposeexpress hCas9 byT7 promoter with polyadenine tails
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72602 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.3-TOPO
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9-polyadenine
-
Alt nameCas9-polyA
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)2508
-
GenBank ID
- Promoter T7
-
Tag
/ Fusion Protein
- 81-bp polyadenylation
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTCCCCTT CTCCCTCTCC A
- 3′ sequencing primer CCCATATGTCCTTCCGAGTG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas9-polyA was a gift from Tomoji Mashimo (Addgene plasmid # 72602 ; http://n2t.net/addgene:72602 ; RRID:Addgene_72602) -
For your References section:
ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Yoshimi K, Kunihiro Y, Kaneko T, Nagahora H, Voigt B, Mashimo T. Nat Commun. 2016 Jan 20;7:10431. doi: 10.1038/ncomms10431. 10.1038/ncomms10431 PubMed 26786405