Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDECKO_Malat1_B
(Plasmid #72621)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72621 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Lentiguide-puro
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNAs toward Malat1
  • gRNA/shRNA sequence
    gRNA1: GCAACTTCCATTTTCAGTCT; gRNA2: GGAAGCCTCAGCTCGCCTGA
  • Species
    H. sapiens (human)
  • Promoter U6 (gRNA1) and H1 (gRNA2)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
  • 3′ sequencing primer hGata4-rev (5'-ATTGTGGATGAATACTGCC-3')
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDECKO_Malat1_B was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 72621 ; http://n2t.net/addgene:72621 ; RRID:Addgene_72621)
  • For your References section:

    DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. Aparicio-Prat E, Arnan C, Sala I, Bosch N, Guigo R, Johnson R. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. 10.1186/s12864-015-2086-z [pii] PubMed 26493208