-
PurposeCRISPR/Cas to target the AAVS1 locus in human cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9 and gRNA for targeting the AAVS1 locus in human cells
-
gRNA/shRNA sequenceGGGGCCACTAGGGACAGGAT
-
SpeciesH. sapiens (human)
- Promoter U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer aggctgttagagagataattgg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is based on pX330-U6-Chimeric_BB-CBh-hSpCas9 from Dr. Feng Zhang (Addgene #42230)(Cong et al, Science, 2013). The AAVS1 target sequence is described in Mali et al (Mali et al, Science, 2013).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1 T2 CRIPR in pX330 was a gift from Masato Kanemaki (Addgene plasmid # 72833 ; http://n2t.net/addgene:72833 ; RRID:Addgene_72833) -
For your References section:
Rapid Protein Depletion in Human Cells by Auxin-Inducible Degron Tagging with Short Homology Donors. Natsume T, Kiyomitsu T, Saga Y, Kanemaki MT. Cell Rep. 2016 Apr 5;15(1):210-8. doi: 10.1016/j.celrep.2016.03.001. Epub 2016 Mar 24. 10.1016/j.celrep.2016.03.001 PubMed 27052166