PMXS-GOT1
(Plasmid
#72872)
-
PurposeThe retroviral GOT1 vector was generated by cloning an sgRNA resistant human GOT1 gene block into the pMXS-ires-blast vector by Gibson Assembly.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXs-IRES-blasticidin
- Backbone size w/o insert (bp) 5639
- Total vector size (bp) 6882
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGOT1
-
Alt nameAST1; cCAT; GIG18; cAspAT; ASTQTL1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1242
-
MutationsgRNA resistant human GOT1, 7 silent mutations c138t, t141c, c144a, c657t,c660a,c663t,c669t
-
GenBank IDNM_002079.2
-
Entrez GeneGOT1 (a.k.a. AST, AST1, ASTQTL1, GIG18, SGOT, cAspAT, cCAT)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCGGATCTAGCTAGTTAATTAAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
It is a retroviral plasmid so it may be recommended to be propagated at 30oc but author typically grows it at 37oC.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PMXS-GOT1 was a gift from David Sabatini (Addgene plasmid # 72872 ; http://n2t.net/addgene:72872 ; RRID:Addgene_72872) -
For your References section:
An Essential Role of the Mitochondrial Electron Transport Chain in Cell Proliferation Is to Enable Aspartate Synthesis. Birsoy K, Wang T, Chen WW, Freinkman E, Abu-Remaileh M, Sabatini DM. Cell. 2015 Jul 30;162(3):540-51. doi: 10.1016/j.cell.2015.07.016. 10.1016/j.cell.2015.07.016 PubMed 26232224