-
PurposeBacterial expression of mouse Drp1 isoform b (699amino acids) with C-terminal His-tag and PreScission protease cleavage site
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21b(+)
-
Backbone manufacturerEMD Millipore (Novagen)
-
Modifications to backbonePreScission protease site inserted via BamHI/HindIII sites
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDrp1
-
Alt nameDynamin-related protein 1
-
Alt nameDNM1L
-
Alt nameDLP1
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_001025947.2
-
Entrez GeneDnm1l (a.k.a. 6330417M19Rik, Dlp1, Dnmlp1, Drp1, python)
- Promoter T7
-
Tags
/ Fusion Proteins
- PreScission Protease site (C terminal on backbone)
- 6xHis-tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGTTATTGCTCAGCGGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21-Drp1 was a gift from David Chan (Addgene plasmid # 72927 ; http://n2t.net/addgene:72927 ; RRID:Addgene_72927) -
For your References section:
The mitochondrial fission receptor Mff selectively recruits oligomerized Drp1. Liu R, Chan DC. Mol Biol Cell. 2015 Dec 1;26(24):4466-77. doi: 10.1091/mbc.E15-08-0591. Epub 2015 Oct 7. 10.1091/mbc.E15-08-0591 PubMed 26446846