pCDH-PGK-Nluc-P2A-copGFP-T2A-Puro
(Plasmid
#73040)
-
PurposeExpress Nluc and copGFP dual reporter in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73040 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH-CMV-MCS
-
Backbone manufacturerSystembio
- Backbone size w/o insert (bp) 6396
- Total vector size (bp) 8387
-
Modifications to backboneClaI/SalI fragment was replaced with EF1s + new MCS
-
Vector typeMammalian Expression, Lentiviral, Luciferase
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNluc-P2A-copGFP-T2A-Puro
-
SpeciesSynthetic
-
Insert Size (bp)2019
- Promoter PGK (phosphoglycerate kinase 1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCCAATAGCAGCTTTGCTCC
- 3′ sequencing primer CAACACCACGGAATTGTCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-PGK-Nluc-P2A-copGFP-T2A-Puro was a gift from Kazuhiro Oka (Addgene plasmid # 73040 ; http://n2t.net/addgene:73040 ; RRID:Addgene_73040)