-
PurposeHuman PIK3CA Wildtype
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73056 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCIG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePIK3CA Wildtype
-
SpeciesH. sapiens (human)
-
Insert Size (bp)9404
-
Entrez GenePIK3CA (a.k.a. CCM4, CLAPO, CLOVE, CWS5, HMH, MCAP, MCM, MCMTC, PI3K, PI3K-alpha, p110-alpha)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gagaggtgcggcggcagcca
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIG PIK3CA Wildtype was a gift from Joseph Gleeson (Addgene plasmid # 73056 ; http://n2t.net/addgene:73056 ; RRID:Addgene_73056) -
For your References section:
An AKT3-FOXG1-reelin network underlies defective migration in human focal malformations of cortical development. Baek ST, Copeland B, Yun EJ, Kwon SK, Guemez-Gamboa A, Schaffer AE, Kim S, Kang HC, Song S, Mathern GW, Gleeson JG. Nat Med. 2015 Dec;21(12):1445-54. doi: 10.1038/nm.3982. Epub 2015 Nov 2. 10.1038/nm.3982 PubMed 26523971