-
PurposeLarge fragment of split HRP fused to the extracellular terminus of neurexin3B. This is a lentiviral plasmid, but can also be used for transfections. Synapsin promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneFSW lentiviral vector
- Backbone size w/o insert (bp) 8451
- Total vector size (bp) 10485
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesHRPa-NRX
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2034
- Promoter Synapsin
-
Tags
/ Fusion Proteins
- Flag tag
- 2x HA tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer CTCCCCTTCCCGGCCACCTTGGTCG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sHRPa is the large split HRP fragment. It consists of amino acids 1-213 of horseradish peroxidase (HRP) with the following 4 mutations: T21I, P78S, R93G, N175S.
The plasmid contains the following features (including promoter region):
PacI-SynapsinP-XbaI- NRX3β ss-AgeI-sHRPa-5 aa linker-flag-MfeI-NRX(36-330 aa)-2x HA-NRX(331-429 aa)-stop-AscI
Human synapsin promoter
5 aa linker: GSGSG
Lentiviral vector. Derived from FCGW with human synapsin1 promoter replacing CMV.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Synapsin sHRPa-NRX in FSW lentiviral vector was a gift from Alice Ting (Addgene plasmid # 73147 ; http://n2t.net/addgene:73147 ; RRID:Addgene_73147) -
For your References section:
A split horseradish peroxidase for the detection of intercellular protein-protein interactions and sensitive visualization of synapses. Martell JD, Yamagata M, Deerinck TJ, Phan S, Kwa CG, Ellisman MH, Sanes JR, Ting AY. Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563. 10.1038/nbt.3563 PubMed 27240195