Skip to main content

Synapsin sHRPa-NRX in FSW lentiviral vector
(Plasmid #73147)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73147 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FSW lentiviral vector
  • Backbone size w/o insert (bp) 8451
  • Total vector size (bp) 10485
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sHRPa-NRX
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2034
  • Promoter Synapsin
  • Tags / Fusion Proteins
    • Flag tag
    • 2x HA tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer CTCCCCTTCCCGGCCACCTTGGTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sHRPa is the large split HRP fragment. It consists of amino acids 1-213 of horseradish peroxidase (HRP) with the following 4 mutations: T21I, P78S, R93G, N175S.

The plasmid contains the following features (including promoter region):
PacI-SynapsinP-XbaI- NRX3β ss-AgeI-sHRPa-5 aa linker-flag-MfeI-NRX(36-330 aa)-2x HA-NRX(331-429 aa)-stop-AscI

Human synapsin promoter
5 aa linker: GSGSG
Lentiviral vector. Derived from FCGW with human synapsin1 promoter replacing CMV.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Synapsin sHRPa-NRX in FSW lentiviral vector was a gift from Alice Ting (Addgene plasmid # 73147 ; http://n2t.net/addgene:73147 ; RRID:Addgene_73147)
  • For your References section:

    A split horseradish peroxidase for the detection of intercellular protein-protein interactions and sensitive visualization of synapses. Martell JD, Yamagata M, Deerinck TJ, Phan S, Kwa CG, Ellisman MH, Sanes JR, Ting AY. Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563. 10.1038/nbt.3563 PubMed 27240195