Skip to main content

YIP sHRPa-Aga1P
(Plasmid #73151)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73151 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    YIP
  • Backbone size w/o insert (bp) 4781
  • Total vector size (bp) 7709
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sHRPa-Aga1P
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2925
  • Promoter glyceraldehyde-3-phosphate dehydrogenase GPD promoter (constitutive)
  • Tag / Fusion Protein
    • V5 tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer atgacattatctttcgctcattttacctacct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sHRPa is the large split HRP fragment. It consists of amino acids 1-213 of horseradish peroxidase (HRP) with the following 4 mutations: T21I, P78S, R93G, N175S.

The insert contains the following features:
BamHI-Aga1P ss-AflII-sHRPa-3 aa linker-V5 epitope tag-9 aa linker-NheI-Aga1P mature-stop-XhoI

glyceraldehyde-3-phosphate dehydrogenase
GPD promoter (constitutive)
3 aa linker: GSG
9 aa linker: GSGGGGSSG
V5 epitope tag: GKPIPNPLLGLDST

This plasmid was derived from the previously published “LAP-Aga1P” plasmid (White and Zegelbone, Biochemistry, 52, 3728-3739, 2013). When this vector is linearized by restriction digest, it incorporates into the yeast genome.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YIP sHRPa-Aga1P was a gift from Alice Ting (Addgene plasmid # 73151 ; http://n2t.net/addgene:73151 ; RRID:Addgene_73151)
  • For your References section:

    A split horseradish peroxidase for the detection of intercellular protein-protein interactions and sensitive visualization of synapses. Martell JD, Yamagata M, Deerinck TJ, Phan S, Kwa CG, Ellisman MH, Sanes JR, Ting AY. Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563. 10.1038/nbt.3563 PubMed 27240195