-
PurposeLarge fragment of split HRP fused to the N-terminus of the yeast mating protein Aga1P. When linearized, this vector incorporates into the yeast genome.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73151 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneYIP
- Backbone size w/o insert (bp) 4781
- Total vector size (bp) 7709
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesHRPa-Aga1P
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2925
- Promoter glyceraldehyde-3-phosphate dehydrogenase GPD promoter (constitutive)
-
Tag
/ Fusion Protein
- V5 tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer atgacattatctttcgctcattttacctacct (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sHRPa is the large split HRP fragment. It consists of amino acids 1-213 of horseradish peroxidase (HRP) with the following 4 mutations: T21I, P78S, R93G, N175S.
The insert contains the following features:
BamHI-Aga1P ss-AflII-sHRPa-3 aa linker-V5 epitope tag-9 aa linker-NheI-Aga1P mature-stop-XhoI
glyceraldehyde-3-phosphate dehydrogenase
GPD promoter (constitutive)
3 aa linker: GSG
9 aa linker: GSGGGGSSG
V5 epitope tag: GKPIPNPLLGLDST
This plasmid was derived from the previously published “LAP-Aga1P” plasmid (White and Zegelbone, Biochemistry, 52, 3728-3739, 2013). When this vector is linearized by restriction digest, it incorporates into the yeast genome.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YIP sHRPa-Aga1P was a gift from Alice Ting (Addgene plasmid # 73151 ; http://n2t.net/addgene:73151 ; RRID:Addgene_73151) -
For your References section:
A split horseradish peroxidase for the detection of intercellular protein-protein interactions and sensitive visualization of synapses. Martell JD, Yamagata M, Deerinck TJ, Phan S, Kwa CG, Ellisman MH, Sanes JR, Ting AY. Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563. 10.1038/nbt.3563 PubMed 27240195