pCfB3048(gRNA XII-2)
(Plasmid
#73290)
-
PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73290 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepESC-Leu
-
Backbone manufacturerAgilent
- Backbone size w/o insert (bp) 7758
- Total vector size (bp) 5289
-
Modifications to backboneGal promoters and terminators removed and Leu selectable marker replaced with NatMX marker. Modified to accept enable USER cloning, with the 20bp recognition sequence replaced to target site XII-2 as reported in: Ronda, C., Maury, J., Jakočiūnas, T., Jacobsen, S. A. et al., CrEdit: CRISPR mediated multi-loci gene integration in Saccharomyces cerevisiae. Microb. Cell Fact. 2015, 14, 97.
-
Vector typeYeast Expression, CRISPR ; gRNA
-
Selectable markersnourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameguiding RNA
-
gRNA/shRNA sequencetgaaactctaatcctactat
-
SpeciesS. cerevisiae (budding yeast)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCfB3048(gRNA XII-2) was a gift from Irina Borodina (Addgene plasmid # 73290 ; http://n2t.net/addgene:73290 ; RRID:Addgene_73290) -
For your References section:
EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Jessop-Fabre MM, Jakociunas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. 10.1002/biot.201600147 PubMed 27166612