Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCfB3050(gRNA XII-5)
(Plasmid #73292)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73292 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pESC-Leu
  • Backbone manufacturer
    Agilent
  • Backbone size w/o insert (bp) 7758
  • Total vector size (bp) 5289
  • Modifications to backbone
    Gal promoters and terminators removed and Leu selectable marker replaced with NatMX marker. Modified to accept enable USER cloning, with the 20bp recognition sequence replaced to target site XII-5 as reported in: Ronda, C., Maury, J., Jakočiūnas, T., Jacobsen, S. A. et al., CrEdit: CRISPR mediated multi-loci gene integration in Saccharomyces cerevisiae. Microb. Cell Fact. 2015, 14, 97.
  • Vector type
    Yeast Expression, CRISPR ; gRNA
  • Selectable markers
    nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    guiding RNA
  • gRNA/shRNA sequence
    ttgtcacagtgtcacatcag
  • Species
    S. cerevisiae (budding yeast)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that mutation A40T in nourseothricin was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCfB3050(gRNA XII-5) was a gift from Irina Borodina (Addgene plasmid # 73292 ; http://n2t.net/addgene:73292 ; RRID:Addgene_73292)
  • For your References section:

    EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Jessop-Fabre MM, Jakociunas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. 10.1002/biot.201600147 PubMed 27166612