Skip to main content
Addgene

pCfB3051(gRNA X-3 XI-2 XII-2)
(Plasmid #73293)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73293 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pESC-Leu
  • Backbone manufacturer
    Agilent
  • Backbone size w/o insert (bp) 7758
  • Total vector size (bp) 6145
  • Modifications to backbone
    Gal promoters and terminators removed and Leu selectable marker replaced with NatMX marker. Modified to accept enable USER cloning, with the 20bp recognition sequence replaced to target site X-3, XI-2, XII-2 as reported in: Ronda, C., Maury, J., Jakočiūnas, T., Jacobsen, S. A. et al., CrEdit: CRISPR mediated multi-loci gene integration in Saccharomyces cerevisiae. Microb. Cell Fact. 2015, 14, 97.
  • Vector type
    Yeast Expression, CRISPR ; gRNA
  • Selectable markers
    nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    guiding RNA
  • gRNA/shRNA sequence
    ctaatgtgtccgcgtttcta, GTTGACCAGTTGATCAGTTG, tgaaactctaatcctactat
  • Species
    S. cerevisiae (budding yeast)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that mutation A40T in nourseothricin was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCfB3051(gRNA X-3 XI-2 XII-2) was a gift from Irina Borodina (Addgene plasmid # 73293 ; http://n2t.net/addgene:73293 ; RRID:Addgene_73293)
  • For your References section:

    EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Jessop-Fabre MM, Jakociunas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. 10.1002/biot.201600147 PubMed 27166612