Skip to main content

PsbA2-HMGS-HMGR-ATOB-NPTI
(Plasmid #73338)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73338 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PUC57 Genescript
  • Backbone size w/o insert (bp) 2657
  • Total vector size (bp) 9332
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HMGS-HMGR-ATOB-NPTI
  • Alt name
    Upper MVA pathway genes
  • Species
    Enterococcus faecalis and Escherichia coli
  • Insert Size (bp)
    6675
  • GenBank ID
    HMGS (AAO81154.1), HMGR (AAO81155.1), ATOB (AKK18188.1),
  • Promoter psbA2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (unknown if destroyed)
  • 3′ cloning site AscI (unknown if destroyed)
  • 5′ sequencing primer ACGATTGCGGCTTTAGCGTTC
  • 3′ sequencing primer GGCGATCGCCCGTTACAATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there are a few discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies are not within the insert region and do NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PsbA2-HMGS-HMGR-ATOB-NPTI was a gift from Anastasios Melis (Addgene plasmid # 73338 ; http://n2t.net/addgene:73338 ; RRID:Addgene_73338)