PsbA2-HMGS-HMGR-ATOB-NPTI
(Plasmid
#73338)
-
PurposeConstruct expressing the upper MVA pathway in Synechocystis PCC 6803
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePUC57 Genescript
- Backbone size w/o insert (bp) 2657
- Total vector size (bp) 9332
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHMGS-HMGR-ATOB-NPTI
-
Alt nameUpper MVA pathway genes
-
SpeciesEnterococcus faecalis and Escherichia coli
-
Insert Size (bp)6675
-
GenBank IDHMGS (AAO81154.1), HMGR (AAO81155.1), ATOB (AKK18188.1),
- Promoter psbA2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (unknown if destroyed)
- 3′ cloning site AscI (unknown if destroyed)
- 5′ sequencing primer ACGATTGCGGCTTTAGCGTTC
- 3′ sequencing primer GGCGATCGCCCGTTACAATT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are a few discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies are not within the insert region and do NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PsbA2-HMGS-HMGR-ATOB-NPTI was a gift from Anastasios Melis (Addgene plasmid # 73338 ; http://n2t.net/addgene:73338 ; RRID:Addgene_73338)