Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #73354)


Item Catalog # Description Quantity Price (USD)
Plasmid 73354 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 32705
  • Total vector size (bp) 35603
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter EF-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site I-CeuI (not destroyed)
  • 3′ cloning site PI-SceI (not destroyed)
  • 5′ sequencing primer AATCTTACTCGGTTACGCCC
  • 3′ sequencing primer CGGCTGCTGCAAAACAGATAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAdx-EF1-tdTomato was a gift from Kazuhiro Oka (Addgene plasmid # 73354 ; ; RRID:Addgene_73354)