pdCas9-M-3A2
(Plasmid
#73435)
-
PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73435 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepdCas9
-
Backbone manufacturerLuciano Marraffini (Addgene plasmid # 46569)
- Backbone size w/o insert (bp) 9296
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRepressor 3A2 (orthogonal T7-lac repressor)
-
gRNA/shRNA sequenceATTAATACGACTCACTATCA
-
SpeciesSynthetic
- Promoter Constitutive wild-type S. pyogenes promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer dCas9-F3 (CACGCATTGATTTGAGTCAGC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Also encodes dCas9 and tracrRNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdCas9-M-3A2 was a gift from Mattheos Koffas (Addgene plasmid # 73435 ; http://n2t.net/addgene:73435 ; RRID:Addgene_73435) -
For your References section:
Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Cress BF, Jones JA, Kim DC, Leitz QD, Englaender JA, Collins SM, Linhardt RJ, Koffas MA. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. 10.1093/nar/gkw231 PubMed 27079979