hPlekhm1-C/pIRES puro Glue (S778-Q986)
(Plasmid
#73457)
-
PurposeExpress human C-terminal part (S778-Q986) Plekhm1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepIRES puro Glue vector
-
Backbone manufacturerAddgene, vector number 15100
- Backbone size w/o insert (bp) 5481
- Total vector size (bp) 6111
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePlekhm1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)627
-
Entrez GenePLEKHM1 (a.k.a. AP162, B2, OPTA3, OPTB6)
-
Tags
/ Fusion Proteins
- strep tag (N terminal on backbone)
- HA tag (N terminal on backbone)
- CBP tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (unknown if destroyed)
- 3′ cloning site Not1 (unknown if destroyed)
- 5′ sequencing primer TGGCGAGAACCTGTACTTCCAG
- 3′ sequencing primer CAAGTGTATGGCCAGATCTCAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hPlekhm1-C/pIRES puro Glue (S778-Q986) was a gift from Paul Odgren (Addgene plasmid # 73457 ; http://n2t.net/addgene:73457 ; RRID:Addgene_73457) -
For your References section:
TRAFD1 (FLN29) Interacts with Plekhm1 and Regulates Osteoclast Acidification and Resorption. Witwicka H, Jia H, Kutikov A, Reyes-Gutierrez P, Li X, Odgren PR. PLoS One. 2015 May 19;10(5):e0127537. doi: 10.1371/journal.pone.0127537. eCollection 2015. 10.1371/journal.pone.0127537 PubMed 25992615