pKLV-U6gRNA(BbsI)-PGKpuro2ABFP-L1mono1
(Plasmid
#73543)
-
PurposeExpression of sgRNA targeting LINE-1 and TagBFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKLV-U6gRNA(BbsI)-PGKpuro2ABFP
-
Backbone manufacturerKosuke Yusa (Addgene plasmid # 50946)
- Backbone size w/o insert (bp) 8102
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLINE-1
-
gRNA/shRNA sequenceCCAGAGGACAGGTGCCCGCC
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer tgtaaacacaaagatattagtacaa
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV-U6gRNA(BbsI)-PGKpuro2ABFP-L1mono1 was a gift from Constance Ciaudo (Addgene plasmid # 73543 ; http://n2t.net/addgene:73543 ; RRID:Addgene_73543) -
For your References section:
Sequestration of LINE-1 in cytosolic aggregates by MOV10 restricts retrotransposition. Arora R, Bodak M, Penouty L, Hackman C, Ciaudo C. EMBO Rep. 2022 Jul 20:e54458. doi: 10.15252/embr.202154458. 10.15252/embr.202154458 PubMed 35856394