shCDK6(1)
(Plasmid
#73552)
-
PurposeshRNA(1) against CDK6
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMLP
- Total vector size (bp) 8000
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA against CDK6
-
gRNA/shRNA sequenceAAGTCTTGCTCCAGTCCAGCTA
-
SpeciesH. sapiens (human)
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer CTTCGCGCCACCTTCTACTCCT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shCDK6(1) was a gift from Gerardo Ferbeyre (Addgene plasmid # 73552 ; http://n2t.net/addgene:73552 ; RRID:Addgene_73552) -
For your References section:
A CDK4/6-Dependent Epigenetic Mechanism Protects Cancer Cells from PML-induced Senescence. Acevedo M, Vernier M, Mignacca L, Lessard F, Huot G, Moiseeva O, Bourdeau V, Ferbeyre G. Cancer Res. 2016 Jun 1;76(11):3252-64. doi: 10.1158/0008-5472.CAN-15-2347. Epub 2016 Mar 29. 10.1158/0008-5472.CAN-15-2347 PubMed 27206849