mOC-STAMP_3xFlag-Myc-CMV26
              
              
                (Plasmid
                
                #73577)
              
            
            
            
          - 
            PurposeExpress mouse OC-STAMP in mammalian cells
- 
              Depositing Lab
- 
          Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbone3xFlag-Myc-CMV26
- 
              Backbone manufacturerSigma Aldrich
- Backbone size w/o insert (bp) 6332
- Total vector size (bp) 7829
- 
              Vector typeMammalian Expression
- 
                Selectable markersNeomycin (select with G418)
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameOC-STAMP
- 
                    SpeciesM. musculus (mouse)
- 
                    GenBank IDNM_029021.1
- 
                        Entrez GeneOcstamp (a.k.a. 4833422F24Rik, OC-STAMP)
- 
    
        Tags
        / Fusion Proteins
    - 3x Flag (N terminal on backbone)
- c-Myc tag (C terminal on backbone)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (unknown if destroyed)
- 3′ cloning site EcoRV (unknown if destroyed)
- 5′ sequencing primer tcttaggcaatgtgcgtgcag (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: mOC-STAMP_3xFlag-Myc-CMV26 was a gift from Paul Odgren (Addgene plasmid # 73577 ; http://n2t.net/addgene:73577 ; RRID:Addgene_73577)
- 
                For your References section: Studies of OC-STAMP in Osteoclast Fusion: A New Knockout Mouse Model, Rescue of Cell Fusion, and Transmembrane Topology. Witwicka H, Hwang SY, Reyes-Gutierrez P, Jia H, Odgren PE, Donahue LR, Birnbaum MJ, Odgren PR. PLoS One. 2015 Jun 4;10(6):e0128275. doi: 10.1371/journal.pone.0128275. eCollection 2015. PONE-D-14-50827 [pii] PubMed 26042409