pMLS256
(Plasmid
#73715)
-
PurposeSapTrap destination vector for building combined sgRNA expression + repair template vectors
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript II
-
Backbone manufacturerAgilent Technologies
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepU6::sgRNA
-
Insert Size (bp)846
-
MutationSapI insertion site
- Promoter C. elegans U6 snRNA pol III promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer M13 (-21) Forward
- 3′ sequencing primer M13 Reverse
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
2nd Insert: SapI repair template insertion site; sgRNA insert can be sequenced with oMLS471: 5' - TCCAAGAACTCGTACAAAAATGCTC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMLS256 was a gift from Erik Jorgensen (Addgene plasmid # 73715 ; http://n2t.net/addgene:73715 ; RRID:Addgene_73715) -
For your References section:
SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Schwartz ML, Jorgensen EM. Genetics. 2016 Feb 2. pii: genetics.115.184275. 10.1534/genetics.115.184275 PubMed 26837755