Skip to main content

pMLS256
(Plasmid #73715)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73715 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript II
  • Backbone manufacturer
    Agilent Technologies
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pU6::sgRNA
  • Insert Size (bp)
    846
  • Mutation
    SapI insertion site
  • Promoter C. elegans U6 snRNA pol III promoter

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

2nd Insert: SapI repair template insertion site; sgRNA insert can be sequenced with oMLS471: 5' - TCCAAGAACTCGTACAAAAATGCTC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMLS256 was a gift from Erik Jorgensen (Addgene plasmid # 73715 ; http://n2t.net/addgene:73715 ; RRID:Addgene_73715)
  • For your References section:

    SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Schwartz ML, Jorgensen EM. Genetics. 2016 Feb 2. pii: genetics.115.184275. 10.1534/genetics.115.184275 PubMed 26837755