-
PurposeExpresses biosensor for cAMP in mammalian cells with nuclear localization signal
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73939 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1 (-)
- Backbone size w/o insert (bp) 5359
- Total vector size (bp) 6622
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenls-Flamindo2
-
Insert Size (bp)1263
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nls-Flamindo2 was a gift from Tetsuya Kitaguchi (Addgene plasmid # 73939 ; http://n2t.net/addgene:73939 ; RRID:Addgene_73939) -
For your References section:
Genetically-encoded yellow fluorescent cAMP indicator with an expanded dynamic range for dual-color imaging. Odaka H, Arai S, Inoue T, Kitaguchi T. PLoS One. 2014 Jun 24;9(6):e100252. doi: 10.1371/journal.pone.0100252. eCollection 2014. PONE-D-14-08126 [pii] PubMed 24959857