Skip to main content

pGex-4T-2_GABARAP
(Plasmid #73948)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73948 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGex-4T-2
  • Backbone manufacturer
    GE Healthcare Life Sciences
  • Backbone size w/o insert (bp) 4970
  • Total vector size (bp) 5320
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GABARAP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    351
  • Entrez Gene
    GABARAP (a.k.a. ATG8A, GABARAP-a, MM46)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH I (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer CCAGCAAGTATATAGCATGG
  • 3′ sequencing primer GCTTACAGACAAGCTGTGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGex-4T-2_GABARAP was a gift from Dieter Willbold (Addgene plasmid # 73948 ; http://n2t.net/addgene:73948 ; RRID:Addgene_73948)
  • For your References section:

    Sequence-specific 1H, 13C and 15N resonance assignments of human GABA receptor associated protein. Stangler T, Mayr LM, Dingley AJ, Luge C, Willbold D. J Biomol NMR. 2001 Oct;21(2):183-4. PubMed 11727985