-
PurposeFor recombinant expression of human GABARAP in E.coli
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73948 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGex-4T-2
-
Backbone manufacturerGE Healthcare Life Sciences
- Backbone size w/o insert (bp) 4970
- Total vector size (bp) 5320
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGABARAP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)351
-
Entrez GeneGABARAP (a.k.a. ATG8A, GABARAP-a, MM46)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer CCAGCAAGTATATAGCATGG
- 3′ sequencing primer GCTTACAGACAAGCTGTGAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGex-4T-2_GABARAP was a gift from Dieter Willbold (Addgene plasmid # 73948 ; http://n2t.net/addgene:73948 ; RRID:Addgene_73948) -
For your References section:
Sequence-specific 1H, 13C and 15N resonance assignments of human GABA receptor associated protein. Stangler T, Mayr LM, Dingley AJ, Luge C, Willbold D. J Biomol NMR. 2001 Oct;21(2):183-4. PubMed 11727985