pCAG-GFP-PQRv3-RFP
(Plasmid
#73951)
-
PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in mammalian cells.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG
-
Backbone manufacturerConnie Cepko
- Backbone size w/o insert (bp) 4796
- Total vector size (bp) 6306
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesfGFP (superfolder GFP)
-
SpeciesH. sapiens (human), M. musculus (mouse), R. norvegicus (rat), Synthetic
-
Insert Size (bp)717
- Promoter Chicken beta actin
-
Tag
/ Fusion Protein
- A residual PQR peptide wii be left at the C-terminal of GFP
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer TGAAGTGGTGGTTGTTCACG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRFP
-
Alt nameTagRFP-T
-
SpeciesH. sapiens (human), M. musculus (mouse), R. norvegicus (rat)
-
Insert Size (bp)732
- Promoter Chicken beta actin (shared with sfGFP as in a bicistronic element)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTGCCCGACAACCACTACT
- 3′ sequencing primer CCCATAATTTTTGGCAGAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byall genes were synthesized
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-GFP-PQRv3-RFP was a gift from Brian Chen (Addgene plasmid # 73951 ; http://n2t.net/addgene:73951 ; RRID:Addgene_73951) -
For your References section:
Quantification of Protein Levels in Single Living Cells. Lo CA, Kays I, Emran F, Lin TJ, Cvetkovska V, Chen BE. Cell Rep. 2015 Dec 22;13(11):2634-44. doi: 10.1016/j.celrep.2015.11.048. Epub 2015 Dec 10. 10.1016/j.celrep.2015.11.048 PubMed 26686644
Map uploaded by the depositor.
