Skip to main content
Addgene

pCAG-GFP-PQRv3-RFP
(Plasmid #73951)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73951 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Backbone manufacturer
    Connie Cepko
  • Backbone size w/o insert (bp) 4796
  • Total vector size (bp) 6306
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sfGFP (superfolder GFP)
  • Species
    H. sapiens (human), M. musculus (mouse), R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    717
  • Promoter Chicken beta actin
  • Tag / Fusion Protein
    • A residual PQR peptide wii be left at the C-terminal of GFP

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer TGAAGTGGTGGTTGTTCACG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    RFP
  • Alt name
    TagRFP-T
  • Species
    H. sapiens (human), M. musculus (mouse), R. norvegicus (rat)
  • Insert Size (bp)
    732
  • Promoter Chicken beta actin (shared with sfGFP as in a bicistronic element)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTGCCCGACAACCACTACT
  • 3′ sequencing primer CCCATAATTTTTGGCAGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    all genes were synthesized

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-GFP-PQRv3-RFP was a gift from Brian Chen (Addgene plasmid # 73951 ; http://n2t.net/addgene:73951 ; RRID:Addgene_73951)
  • For your References section:

    Quantification of Protein Levels in Single Living Cells. Lo CA, Kays I, Emran F, Lin TJ, Cvetkovska V, Chen BE. Cell Rep. 2015 Dec 22;13(11):2634-44. doi: 10.1016/j.celrep.2015.11.048. Epub 2015 Dec 10. 10.1016/j.celrep.2015.11.048 PubMed 26686644