-
PurposeExpress c-Myc-tagged human AIM2 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationNorthwestern University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 73958-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 73958-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5459
- Total vector size (bp) 6600
-
Modifications to backboneA c-myc tag and a modified MCS were inserted as indicated in the attached plasmid map.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameabsent in melanoma 2 (AIM2)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1050
-
GenBank IDNM_004833.1
-
Entrez GeneAIM2 (a.k.a. PYHIN4)
- Promoter CMV iE
-
Tag
/ Fusion Protein
- c-myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer T7 promoter (TAATACGACTCACTATAGGG)
- 3′ sequencing primer SP6 promoter (ATTTAGGTGACACTATAG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 73958-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 73958-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-Myc-AIM2 was a gift from Christian Stehlik (Addgene plasmid # 73958 ; http://n2t.net/addgene:73958 ; RRID:Addgene_73958) -
For your References section:
The PYRIN domain-only protein POP3 inhibits ALR inflammasomes and regulates responses to infection with DNA viruses. Khare S, Ratsimandresy RA, de Almeida L, Cuda CM, Rellick SL, Misharin AV, Wallin MC, Gangopadhyay A, Forte E, Gottwein E, Perlman H, Reed JC, Greaves DR, Dorfleutner A, Stehlik C. Nat Immunol. 2014 Apr;15(4):343-53. doi: 10.1038/ni.2829. Epub 2014 Feb 16. 10.1038/ni.2829 PubMed 24531343
Map uploaded by the depositor.
Map uploaded by the depositor.
