pcDNA3-Myc-AIM2
(Plasmid #73958)

• Purpose: Express c-Myc-tagged human AIM2 in mammalian cells
• Depositing Lab: Christian Stehlik
• Publication: Khare et al Nat Immunol. 2014 Apr;15(4):343-53. doi: 10.1038/ni.2829. Epub 2014 Feb 16.

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5459
• Total vector size (bp): 6600
• Modifications to backbone: A c-myc tag and a modified MCS were inserted as indicated in the attached plasmid map.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: absent in melanoma 2 (AIM2)
• Species: H. sapiens (human)
• Insert Size (bp): 1050
• GenBank ID: NM_004833.1
• Entrez Gene: AIM2 (a.k.a. PYHIN4)
• Promoter: CMV iE
• Tag / Fusion Protein:
  • c-myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: T7 promoter (TAATACGACTCACTATAGGG)
• 3′ sequencing primer: SP6 promoter (ATTTAGGTGACACTATAG)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry