Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CAG-EGFP-Otx2shRNA2
(Plasmid #73982)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73982 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    CAG-GFP
  • Backbone manufacturer
    Addgene (Plasmid #11150)
  • Backbone size w/o insert (bp) 5552
  • Total vector size (bp) 5685
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EGFP-Otx2-shRNA2
  • gRNA/shRNA sequence
    ataacctgaagcctgagtata
  • Species
    M. musculus (mouse)
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gttcggcttctggcgtgt
  • 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-EGFP-Otx2shRNA2 was a gift from Connie Cepko (Addgene plasmid # 73982 ; http://n2t.net/addgene:73982 ; RRID:Addgene_73982)
  • For your References section:

    A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Wang S, Sengel C, Emerson MM, Cepko CL. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21. 10.1016/j.devcel.2014.07.018 PubMed 25155555