B51
(Plasmid
#74005)
-
PurposegRNA for B108
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74005 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx330
-
Backbone manufacturerpurchased from addgene
- Backbone size w/o insert (bp) 8489
- Total vector size (bp) 8509
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA
-
gRNA/shRNA sequenceAGGATCCTCCAGAGGAGAGC
-
SpeciesM. musculus (mouse)
- Promoter U6
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site none (unknown if destroyed)
- 3′ cloning site none (unknown if destroyed)
- 5′ sequencing primer gagggcctatttcccatgat
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B51 was a gift from Connie Cepko (Addgene plasmid # 74005 ; http://n2t.net/addgene:74005 ; RRID:Addgene_74005) -
For your References section:
A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Wang S, Sengel C, Emerson MM, Cepko CL. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21. 10.1016/j.devcel.2014.07.018 PubMed 25155555