-
Purposeretroviral plasmid for expression of FLAG-tagged human Ikaros corresponding to cDNA from XM_011515058.1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74046 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMSCV-IRES-GFP (pMIG)
- Backbone size w/o insert (bp) 7200
- Total vector size (bp) 8721
-
Modifications to backbonesv40 ori added
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman Ikaros (IKZF1)
-
Alt nameIKZF1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1650
-
GenBank IDXM_011515058.1
-
Entrez GeneIKZF1 (a.k.a. CVID13, Hs.54452, IK1, IKAROS, LYF1, LyF-1, PPP1R92, PRO0758, ZNFN1A1)
- Promoter pMSCV-LTRs
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (not destroyed)
- 3′ cloning site XHO1 (not destroyed)
- 5′ sequencing primer CGTTCGACCCCGCCTCGATCC
- 3′ sequencing primer AGCTTGATATCGAATTCCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycloned from cDNA (human CD4+ cells), corresponds to ORF from transcript variants X1, X3, X5-X9
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-FLAG-hIKAROS-IRES-GFP was a gift from Ria Baumgrass (Addgene plasmid # 74046 ; http://n2t.net/addgene:74046 ; RRID:Addgene_74046) -
For your References section:
Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333