pMIG-hNFATc2/C(RIT)-FLAG-AVITEV
(Plasmid
#74053)
-
Purposeretroviral expression plasmid for human NFATc2/C (with RIT mutation abrogating AP1 binding) with C-terminal BirA-biotinylation signal and TEV celavage site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCV-IRES-GFP (pMIG)
- Backbone size w/o insert (bp) 7200
- Total vector size (bp) 9951
-
Modifications to backboneadded SV40 ori
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman NFATc2, isoform C
-
Alt nameNFAT1
-
Alt namenuclear factor of activated T-cells 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2900
-
Mutationsilent mutation A1723C in the sequence of NM_173091.3 (A1503C position in ORF of the vector); RIT mutations (R466A-I467A-T533A) abbrogating AP-1 interaction
-
GenBank IDNM_173091.3 Gene-ID: 4773
-
Entrez GeneNFATC2 (a.k.a. JCOSL, NFAT1, NFATP)
- Promoter pMSCV-LTRs
-
Tags
/ Fusion Proteins
- FLAG (C terminal on insert)
- AVI-TEV (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (not destroyed)
- 3′ cloning site SnaB1, Sgf1 (not destroyed)
- 5′ sequencing primer CGTTCGACCCCGCCTCGATCC
- 3′ sequencing primer AGCTTGATATCGAATTCCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Avi-Tev-Tag is biotinylated by BirA E.coli biotin ligase when coexpressed, and can be cleaved by TEV protease. RIT mutation as described for mouse NFAT in Macian et al, EMBO J. (2000), 19, issue 17, p4783ff.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMIG-hNFATc2/C(RIT)-FLAG-AVITEV was a gift from Ria Baumgrass (Addgene plasmid # 74053 ; http://n2t.net/addgene:74053 ; RRID:Addgene_74053) -
For your References section:
Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333