pZ8-P_dCas9
(Plasmid
#74063)
-
PurposepZ8-1 plasmid carrying dcas9 driven by the propionate-inducible prpD2 promoter (PprpD2), KanR
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74063 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZ8-Prp
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedcas9
- Promoter Propionate inducible promoter (prp)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCAGCCATCGGAAGCTGTGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZ8-P_dCas9 was a gift from Timothy Lu (Addgene plasmid # 74063 ; http://n2t.net/addgene:74063 ; RRID:Addgene_74063) -
For your References section:
Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). Cleto S, Jensen JV, Wendisch VF, Lu TK. ACS Synth Biol. 2016 Feb 16. 10.1021/acssynbio.5b00216 PubMed 26829286