pTU2S-a (p15A origin)
(Plasmid
#74088)
-
PurposeSecondary module (BpiI) site in pTU2-a backbone with p15A (low-copy) origin of replication
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep15A origin and chloramphenicol resistance
-
Backbone manufacturerTerrence Lai (this study)
- Backbone size w/o insert (bp) 2024
- Total vector size (bp) 2137
-
Modifications to backboneModifications between XbaI and PstI from original pSB1C3 plasmid. CAT gene - C435G (nucleotide) - silent mutagenesis to remove BsmBI site
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions10 ml LB culture - use 2X P1, P2 and N3 buffer for mini-prep purification and concentrate elution fraction (~10-20 ng/ul in 50 ul total volume of water) until 50 ng/ul for Golden Gate
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGolden Gate destination vector - Level 2, 2 TU's with secondary module and p15A origin
-
SpeciesSynthetic
- Promoter None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer CAGGGGATAACGCAGGAAAG
- 3′ sequencing primer AACCGTATTACCGCCTTTGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTU2S-a (p15A origin) was a gift from Paul Freemont (Addgene plasmid # 74088 ; http://n2t.net/addgene:74088 ; RRID:Addgene_74088) -
For your References section:
EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology. Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. ACS Synth Biol. 2016 May 2. 10.1021/acssynbio.6b00031 PubMed 27096716