Skip to main content

pBP-TL9
(Plasmid #74098)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74098 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB1C3
  • Backbone manufacturer
    iGEM
  • Backbone size w/o insert (bp) 2044
  • Total vector size (bp) 2134
  • Modifications to backbone
    Modifications between XbaI and PstI from original pSB1C3 plasmid. CAT gene - C435G (nucleotide) - silent mutagenesis to remove BsmBI site
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TL9 RBS
  • Alt name
    Shine-Dalgarno sequence (weak)
  • Species
    Synthetic
  • Insert Size (bp)
    42
  • GenBank ID
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains the TL9 RBS upstream of GFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBP-TL9 was a gift from Paul Freemont (Addgene plasmid # 74098 ; http://n2t.net/addgene:74098 ; RRID:Addgene_74098)
  • For your References section:

    EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology. Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. ACS Synth Biol. 2016 May 2. 10.1021/acssynbio.6b00031 PubMed 27096716