pLCKO_LacZ_sgRNA
(Plasmid
#74179)
-
Purposelentiviral vector expressing sgRNA targeting LacZ
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74179 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLCKO
-
Backbone manufacturerMoffat Lab
- Total vector size (bp) 7565
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLacZ sgRNA
-
gRNA/shRNA sequenceCCCGAATCTCTATCGTGCGG
- Promoter U6 Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BfuAI (destroyed during cloning)
- 3′ cloning site BfuAI (destroyed during cloning)
- 5′ sequencing primer U6 fwd (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLCKO_LacZ_sgRNA was a gift from Jason Moffat (Addgene plasmid # 74179 ; http://n2t.net/addgene:74179 ; RRID:Addgene_74179) -
For your References section:
High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Hart T, Chandrashekhar M, Aregger M, Steinhart Z, Brown KR, MacLeod G, Mis M, Zimmermann M, Fradet-Turcotte A, Sun S, Mero P, Dirks P, Sidhu S, Roth FP, Rissland OS, Durocher D, Angers S, Moffat J. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25. 10.1016/j.cell.2015.11.015 PubMed 26627737