pMXspuro-GFP-NBR1-dUBA
(Plasmid
#74205)
-
PurposeRetroviral expression of GFP-NBR1 with aa 877 mutation to generate a premature stop codon
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMXs-puro
- Backbone size w/o insert (bp) 6900
- Total vector size (bp) 10200
-
Modifications to backboneInsert was digested with BglII/XhoI to ligate into the vector which was digested with BamHI/XhoI.
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameneighbor of BRCA1 gene 1
-
Alt nameNBR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2631
-
MutationChanged aa 877 to encode for premature stop codon
-
Entrez GeneNBR1 (a.k.a. 1A1-3B, IAI3B, M17S2, MIG19)
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GACGGCATCGCAGCTTGGATACAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGFP-NBR1 was cloned from pMXs-IP-GFP-NBR1, a gift from Noboru Mizushima (Addgene plasmid # 38283)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXspuro-GFP-NBR1-dUBA was a gift from Jayanta Debnath (Addgene plasmid # 74205 ; http://n2t.net/addgene:74205 ; RRID:Addgene_74205) -
For your References section:
NBR1 enables autophagy-dependent focal adhesion turnover. Kenific CM, Stehbens SJ, Goldsmith J, Leidal AM, Faure N, Ye J, Wittmann T, Debnath J. J Cell Biol. 2016 Feb 29;212(5):577-590. Epub 2016 Feb 22. 10.1083/jcb.201503075 PubMed 26903539