pRL-ubi63E
(Plasmid
#74280)
-
PurposeRenilla control plasmid driven by the ubiquitin 63E promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRL
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRenilla luciferase
- Promoter ubiquitin 63E promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Rluc-R TTTACATCTGGCCCACCACT
- 3′ sequencing primer EBV-Rev (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRL-ubi63E was a gift from Alexander Stark (Addgene plasmid # 74280 ; http://n2t.net/addgene:74280 ; RRID:Addgene_74280) -
For your References section:
Genome-wide quantitative enhancer activity maps identified by STARR-seq. Arnold CD, Gerlach D, Stelzer C, Boryn LM, Rath M, Stark A. Science. 2013 Mar 1;339(6123):1074-7. doi: 10.1126/science.1232542. Epub 2013 Jan 17. 10.1126/science.1232542 PubMed 23328393