pMOD8A-RGR-r10
(Plasmid
#74370)
-
PurposeThis plasmid constitutively expresses gRNA-r10 from an AHD1 promoter using the RGR design. Integrates in the W303 HIS locus and restores HIS function.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74370 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMOD8
-
Backbone manufacturerKlavins Lab
- Backbone size w/o insert (bp) 4629
- Total vector size (bp) 6586
-
Vector typeYeast Expression, CRISPR, Synthetic Biology
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRGR-r10
-
gRNA/shRNA sequencer10
-
SpeciesSynthetic
- Promoter ADH1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctagaactagtggatctacaaa
- 3′ sequencing primer cggggcggggttattacgacat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2016/03/02/041871 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMOD8A-RGR-r10 was a gift from Eric Klavins (Addgene plasmid # 74370 ; http://n2t.net/addgene:74370 ; RRID:Addgene_74370) -
For your References section:
Robust digital logic circuits in eukaryotic cells with CRISPR/dCas9 NOR gates. Gander MW, Vrana JD, Voje Jr WE, Carothers JM, Klavins E. bioRxiv 041871 10.1101/041871