pEF-hSEMA4C-Fc
(Plasmid
#74449)
-
PurposeExpresses human Semaphorin-4C ectodomain fused to human Fc in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74449 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEF-BOS
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 8696
-
Modifications to backboneThe plasmid pEF-BOS-hSEMA4D-Fc (Kumanogoh et al., 2000) was modified by cutting out the Sema4D-ectodomain and inserting a SEMA4C ectodomain fragment.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Semaphorin-4C ectodomain with human Fc tag
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3261
-
GenBank IDNM_017789.4
-
Entrez GeneSEMA4C (a.k.a. M-SEMA-F, SEMACL1, SEMAF, SEMAI)
- Promoter EF1-alpha
-
Tag
/ Fusion Protein
- human Fc tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer EF-F CATTCTCAAGCCTCAGACAGTGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe hSEMA4C ectodomain fragment was amplified by PCR from the cDNA plasmid IMAGE #40035252
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF-hSEMA4C-Fc was a gift from Roland Friedel (Addgene plasmid # 74449 ; http://n2t.net/addgene:74449 ; RRID:Addgene_74449) -
For your References section:
Plexin-B2 promotes invasive growth of malignant glioma. Le AP, Huang Y, Pingle SC, Kesari S, Wang H, Yong RL, Zou H, Friedel RH. Oncotarget. 2015 Mar 30;6(9):7293-304. 10.18632/oncotarget.3421 PubMed 25762646