Skip to main content

pCM66T: trimmed pCM66 backbone
(Plasmid #74738)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74738 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCM66
  • Backbone size (bp) 5708
  • Modifications to backbone
    removed noncoding components

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgattcattaatgcagctggcac
  • 3′ sequencing primer cctctgacacatgcagctccc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Similar backbone to pAWP78 (AddGene plasmid 61263)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCM66T: trimmed pCM66 backbone was a gift from Mary Lidstrom (Addgene plasmid # 74738 ; http://n2t.net/addgene:74738 ; RRID:Addgene_74738)