-
PurposeKillerOrange gene for bacterial expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74748 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepQE-30
-
Backbone manufacturerQIAGEN
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 4250
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameKillerOrange
-
Alt nameKO, Killer Orange
-
SpeciesSynthetic
-
Insert Size (bp)723
-
MutationKillerRed with substitutions G3C Y66W D113S N145S F177L Y221H E236Q
-
GenBank IDKX377673 KX377673
- Promoter T5
-
Tag
/ Fusion Protein
- HisTag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATTGTGAGCGGATAACAATTTC
- 3′ sequencing primer CCGAGCGTTCTGAACAAATC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KillerOrange /pQE-30 was a gift from Konstantin Lukyanov (Addgene plasmid # 74748 ; http://n2t.net/addgene:74748 ; RRID:Addgene_74748) -
For your References section:
KillerOrange, a Genetically Encoded Photosensitizer Activated by Blue and Green Light. Sarkisyan KS, Zlobovskaya OA, Gorbachev DA, Bozhanova NG, Sharonov GV, Staroverov DB, Egorov ES, Ryabova AV, Solntsev KM, Mishin AS, Lukyanov KA. PLoS One. 2015 Dec 17;10(12):e0145287. doi: 10.1371/journal.pone.0145287. eCollection 2015. PONE-D-15-27043 [pii] PubMed 26679300