Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

KillerOrange /pQE-30
(Plasmid #74748)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74748 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQE-30
  • Backbone manufacturer
    QIAGEN
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 4250
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    KillerOrange
  • Alt name
    KO, Killer Orange
  • Species
    Synthetic
  • Insert Size (bp)
    723
  • Mutation
    KillerRed with substitutions G3C Y66W D113S N145S F177L Y221H E236Q
  • GenBank ID
    KX377673 KX377673
  • Promoter T5
  • Tag / Fusion Protein
    • HisTag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATTGTGAGCGGATAACAATTTC
  • 3′ sequencing primer CCGAGCGTTCTGAACAAATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KillerOrange /pQE-30 was a gift from Konstantin Lukyanov (Addgene plasmid # 74748 ; http://n2t.net/addgene:74748 ; RRID:Addgene_74748)
  • For your References section:

    KillerOrange, a Genetically Encoded Photosensitizer Activated by Blue and Green Light. Sarkisyan KS, Zlobovskaya OA, Gorbachev DA, Bozhanova NG, Sharonov GV, Staroverov DB, Egorov ES, Ryabova AV, Solntsev KM, Mishin AS, Lukyanov KA. PLoS One. 2015 Dec 17;10(12):e0145287. doi: 10.1371/journal.pone.0145287. eCollection 2015. PONE-D-15-27043 [pii] PubMed 26679300