pIS1
(Plasmid
#74887)
-
Purposetargeting vector for C-terminal eGFP tag on Drosophila melanogaster Act5C
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMH3
- Backbone size w/o insert (bp) 4270
- Total vector size (bp) 5190
-
Vector typeInsect Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameAct5C upstream homology region
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)500
-
Tag
/ Fusion Protein
- eGFP (C terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer pJet fwd
- 3′ sequencing primer aagtcgtgctgcttcatgtg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAct5C downstream homology
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)420
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TTGAAAGAGCAACGGCTACAATCAAC
- 3′ sequencing primer pJet rev (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIS1 was a gift from Klaus Foerstemann (Addgene plasmid # 74887 ; http://n2t.net/addgene:74887 ; RRID:Addgene_74887) -
For your References section:
A Comprehensive Toolbox for Genome Editing in Cultured Drosophila melanogaster Cells. Kunzelmann S, Bottcher R, Schmidts I, Forstemann K. G3 (Bethesda). 2016 Jun 1;6(6):1777-85. doi: 10.1534/g3.116.028241. 10.1534/g3.116.028241 PubMed 27172193