Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pIS1
(Plasmid #74887)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74887 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMH3
  • Backbone size w/o insert (bp) 4270
  • Total vector size (bp) 5190
  • Vector type
    Insect Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Act5C upstream homology region
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    500
  • Tag / Fusion Protein
    • eGFP (C terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer pJet fwd
  • 3′ sequencing primer aagtcgtgctgcttcatgtg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Act5C downstream homology
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    420

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TTGAAAGAGCAACGGCTACAATCAAC
  • 3′ sequencing primer pJet rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS1 was a gift from Klaus Foerstemann (Addgene plasmid # 74887 ; http://n2t.net/addgene:74887 ; RRID:Addgene_74887)
  • For your References section:

    A comprehensive toolbox for genome editing in cultured Drosophila cells. Kunzelmann S, Böttcher R, Schmidts I, and Förstemann K.. G3 (Bethesda). Published online April 13,2016 10.1534/g3.116.028241