pIS1
(Plasmid #74887)

• Purpose: targeting vector for C-terminal eGFP tag on Drosophila melanogaster Act5C
• Depositing Lab: Klaus Foerstemann
• Publication: Kunzelmann et al G3 (Bethesda). 2016 Jun 1;6(6):1777-85. doi: 10.1534/g3.116.028241.

Backbone

• Vector backbone: pMH3
• Backbone size w/o insert (bp): 4270
• Total vector size (bp): 5190
• Vector type: Insect Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Act5C upstream homology region
• Species: D. melanogaster (fly)
• Insert Size (bp): 500
• Tag / Fusion Protein:
  • eGFP (C terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: pJet fwd
• 3′ sequencing primer: aagtcgtgctgcttcatgtg

Gene/Insert 2

• Gene/Insert name: Act5C downstream homology
• Species: D. melanogaster (fly)
• Insert Size (bp): 420

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TTGAAAGAGCAACGGCTACAATCAAC
• 3′ sequencing primer: pJet rev

Resource Information

• Supplemental Documents:
  • Genomic Tagging in Drosophila cells (N-terminal constructs)
  • Genomic Tagging in Drosophila cells (C-terminal constructs)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry