pMSCV-puro-TTF-1-HDD
(Plasmid
#74991)
-
PurposeRetroviral vector holding human TTF-1 (NKX2-1) with the homeodomain deleted
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74991 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV-Puro
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTTF-1 HDD mutant
-
Alt nameNKX2-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)972
-
MutationHDD = homeodomain deleted
-
Entrez GeneNKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-puro-TTF-1-HDD was a gift from David Mu (Addgene plasmid # 74991 ; http://n2t.net/addgene:74991 ; RRID:Addgene_74991) -
For your References section:
Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome. Wood LW, Cox NI, Phelps CA, Lai SC, Poddar A, Talbot C Jr, Mu D. Sci Rep. 2016 Feb 25;6:19857. doi: 10.1038/srep19857. 10.1038/srep19857 PubMed 26912193