Skip to main content

pMX-HA-UbvG08_MUT-IRES-GFP
(Plasmid #75031)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 75031 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pMX-IRES-GFP
  • Backbone manufacturer
    Cell Biolabs, Inc.
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 6184
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ubiquitin
  • Alt name
    synthetic engineered ubiquitin variant UbvG08 (i53 DM - mutant)
  • Alt name
    pMX-HA-i53-DM-IRES-GFP
  • Species
    Synthetic
  • Insert Size (bp)
    284
  • Mutation
    UbvG08 with I44A, P69L, and L70V mutations and no terminal Glycines
  • Tags / Fusion Proteins
    • HA (N terminal on insert)
    • IRES-eGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site PacI (unknown if destroyed)
  • 5′ sequencing primer GACGGCATCGCAGCTTGGATACAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

bioRxiv (10.1101/060954)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMX-HA-UbvG08_MUT-IRES-GFP was a gift from Daniel Durocher (Addgene plasmid # 75031 ; http://n2t.net/addgene:75031 ; RRID:Addgene_75031)
  • For your References section:

    Inhibition of 53BP1 favors homology-dependent DNA repair and increases CRISPR-Cas9 genome-editing efficiency. Canny MD, Moatti N, Wan LCK, Fradet-Turcotte A, Krasner D, Mateos-Gomez PA, Zimmermann M, Orthwein A, Juang YC, Zhang W, Noordermeer SM, Seclen E, Wilson MD, Vorobyov A, Munro M, Ernst A, Ng TF, Cho T, Cannon PM, Sidhu SS, Sicheri F, Durocher D. Nat Biotechnol. 2018 Jan;36(1):95-102. doi: 10.1038/nbt.4021. Epub 2017 Nov 27. 10.1038/nbt.4021 PubMed 29176614