pP2AeGFP-Mars1Cy
(Plasmid
#75223)
-
PurposeMammalian intracellular expression of fluorogen activating protein Mars1Cy and eGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3958
- Total vector size (bp) 5476
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-p2a-Mars1Cy
-
Alt nameEGFP-p2a-dL9.5
-
SpeciesSynthetic
-
Insert Size (bp)1518
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer ctctacaaatgtggtatggctg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pP2AeGFP-Mars1Cy was a gift from Alan Waggoner (Addgene plasmid # 75223 ; http://n2t.net/addgene:75223 ; RRID:Addgene_75223) -
For your References section:
Fluoromodule-based reporter/probes designed for in vivo fluorescence imaging. Zhang M, Chakraborty SK, Sampath P, Rojas JJ, Hou W, Saurabh S, Thorne SH, Bruchez MP, Waggoner AS. J Clin Invest. 2015 Oct 1;125(10):3915-27. doi: 10.1172/JCI81086. Epub 2015 Sep 8. 10.1172/JCI81086 PubMed 26348895