Skip to main content

pHAGE-TO-dCas9
(Plasmid #75381)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75381 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE-DEST
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 10829
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sp dCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4101
  • Promoter CMV-TO
  • Tag / Fusion Protein
    • no

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR I (not destroyed)
  • 3′ cloning site Xba I (not destroyed)
  • 5′ sequencing primer cgaaggaatagaagaagaaggtgga
  • 3′ sequencing primer CCAAAGGGAGATCCGACTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Want all of the CRISPRainbow constructs? Request the set here: https://www.addgene.org/kits/pederson-crisprainbow/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE-TO-dCas9 was a gift from Thoru Pederson (Addgene plasmid # 75381 ; http://n2t.net/addgene:75381 ; RRID:Addgene_75381)
  • For your References section:

    Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Ma H, Tu LC, Naseri A, Huisman M, Zhang S, Grunwald D, Pederson T. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. 10.1038/nbt.3526 PubMed 27088723