Skip to main content

pEGB 35s:dCas:VP64:tNos (GB1189)
(Plasmid #75403)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75403 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDGB3alpha2
  • Backbone manufacturer
    self-made; derived from pCambia1302 generated at the Cambia Institute
  • Backbone size w/o insert (bp) 5849
  • Total vector size (bp) 12267
  • Vector type
    Plant Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas:VP64
  • Species
    Synthetic
  • Insert Size (bp)
    5898
  • Promoter 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GGTGGCAGGATATATTGTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGB 35s:dCas:VP64:tNos (GB1189) was a gift from Diego Orzaez (Addgene plasmid # 75403 ; http://n2t.net/addgene:75403 ; RRID:Addgene_75403)
  • For your References section:

    A modular toolbox for gRNA-Cas9 genome engineering in plants based on the GoldenBraid standard. Vazquez-Vilar M, Bernabe-Orts JM, Fernandez-Del-Carmen A, Ziarsolo P, Blanca J, Granell A, Orzaez D. Plant Methods. 2016 Feb 1;12:10. doi: 10.1186/s13007-016-0101-2. eCollection 2016. 101 [pii] PubMed 26839579