pECT5
              
              
                (Plasmid
                
                #75451)
              
            
            
            
          - 
            PurposePlasmid that serves as the PCR template to create genomic pdt5 insertions. Plasmid contains the R6K origin of replication so needs pir gene to replicate
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75451 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepWM91
 - 
              Modifications to backboneremoved sacB and lacZ genes and replaced with kan cassette from Datsenko et al. as well as the indicated pdt insertion
 - 
              Vector typeBacterial Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)Pir1
 - 
            Copy numberLow Copy
 
Gene/Insert
- 
                Gene/Insert namepdt5
 - 
                    SpeciesE. coli
 - Promoter none
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer AATCAGCTGTTGCCCGTCTC (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pECT5 was a gift from James Collins (Addgene plasmid # 75451 ; http://n2t.net/addgene:75451 ; RRID:Addgene_75451) - 
                
For your References section:
Tunable protein degradation in bacteria. Cameron DE, Collins JJ. Nat Biotechnol. 2014 Dec;32(12):1276-81. doi: 10.1038/nbt.3053. Epub 2014 Nov 17. 10.1038/nbt.3053 PubMed 25402616